630.443 ȿ.ȼ. Ⱦɚɜɢɞɟɧɤɨ Ʉ ȼɈɉɊɈɋɍ ɈȻ ɂɁɍɑȿɇɂɂ ɉȺɌɈȽȿɇɇɕɏ ȽɊɂȻɈȼ ɋɈɋɇɈȼɕɏ ɇȺɋȺɀȾȿɇɂɃ ɘȽȺ ɍɄɊȺɂɇɕ ȼɜɟɞɟɧɢɟ. , ( 1960- . ), . - , ( , ), , , - [1, 2]. , , , [1, 3, 4]. , - , , . . , - , , . Ɇɟɬɨɞɢɤɚ ɩɪɨɜɟɞɟɧɢɹ ɢɫɫɥɟɞɨɜɚɧɢɹ. (Pinus sylvestris L.) Lamb.) , . ( 7 , , : ) ( ( ), ), ( 3 - ). (P. pallasiana) . . , , - 5 . (Pinus sylvestris) 164 (P. pallasiana 2–6, 7–12 ( 360 15–25 - . . , , .). - . . 3–14 . [2, 5, 6]. - . , , . ( ) 70° . , 13000 / , 40 50 . 70 % - [1, 7–9]. , . , Dothistroma pini EFI-αDPtef-F (5` ATTTTTCGCTGCTCGTCACT 3`) DPtef-R (5` CAATGTGAGATGTTCGTCGTG 3`), Dothistroma septosporum β-tubulin Dstub2-F (5`CGAACATGGACTGAGCAAAAC 3`) DStub2-R (5` GCACGGCTCTTTCAAATGAC 3`) [9]. 20 . Applied Biosystems GeneAmp PCR System 2700 . 95 °C 5 , 35 : 95 °C 30 , 60 ° 30 , 72 ° 30 . 72 ° 7 [9]. 1% , SB 100 V 60 , . ( , ), « »( , ). ( , ) FP 1102 DIAROD. Excel 2007 Statistica 6.0. P = 0,05. COST 2011–2013 . Microsoft - 165 - . 2014. . 207 Ɋɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɣ. , ( 80 % ), , . 10 , : Alternaria sp., Dothistroma sp., Fusarium sp., Fusicoccum sp., Gremmeniella abietina (Lagerb.) M. Morelet, Lophodermium seditiosum Minter Staley, Phomopsis sp., Sphaeropsis sapinea (Fr.) Dyko & B. Sutton ( Diplodia pinea (Desm.) J. Kickx), Sclerophoma pithyophila (Corda) Hohn, Cyclaneusma minus (Butin) Di Cosmo ( . 1). S. pithyophila S. sapinea 20,8 %, 14,2 %), Alternaria sp. ( 10,6 % ( . 1). G. abietina ( 13,9 %), , - – S. pithyophila, . , , - , [5, 6]. , 38,3 % - 10,6 % 1 ɉɟɪɟɱɟɧɶ ɮɢɬɨɩɚɬɨɝɟɧɨɜ, ɜɵɹɜɥɟɧɧɵɯ ɧɚ ɯɜɨɟ ɫɨɫɧɵ ɨɛɵɤɧɨɜɟɧɧɨɣ ɢ ɤɪɵɦɫɤɨɣ ,% Alternaria sp. Fusarium sp. Gremmeniella abietina (Lagerb.) M. Morelet Lophodermium seditiosum Minter, Staley Phomopsis sp. Sclerophoma pithyophila (Corda) Hohn. Sphaeropsis sapinea (Fr.) Dyko & B. Sutton 22,5 11,7 37,5 3,3 5,8 10,0 4,2 1,7 2,5 4,2 0,0 0,0 30,0 10,0 17,5 3,3 0,8 10,0 0,0 22,5 17,5 Alternaria sp. Cyclaneusma minus (Butin) Di Cosmo Dothistroma pini Hulbary Fusarium sp. Fusicoccum sp. Sclerophoma pithyophila (Corda) Hohn. Sphaeropsis sapinea (Fr.) Dyko & B. Sutton 43,3 0,0 22,5 9,2 0,0 43,3 20,0 0,0 0,0 60,8 0,8 55,8 17,5 51,7 5,0 10,0 57,5 1,7 61,7 34,2 43,3 166 . . – S. sapinea, , - , . - . - [7, 10, 11]. ( ), Gremmeniella abietina. 37,5 % Fusarium , (4,2 Alternaria , 0,8 % ). - . , . , . , Lophodermium seditiosum – . 3,3 % , - . [1, 3, 4, 6]. Dothistroma sp. (46,9 %), Fusicoccum sp. (39,2 %), S. sapinea (38,3 %) S. pithyophila (31,7 %) ( . 1). , - - , , . , . , 1–3 Dothistroma sp., [2, 6, 8, 9, 12]. – Dothistroma septosporum ( ( ). , , , - . Mycosphaerella pini) Dothistroma pini 80 . , – , , , , 167 - . 2014. ( band needle blight). – . 207 , Dothistroma needle blight red, , [2, 8, 9, 12]. 100 [2, 12]. 2005 , - [8, 9, 12]. - , D. pini. D. septosporum ositive – ), negative – , ( . 1). , - ( ( ). , (55,8 , 61,7 %? ), Fusicoccum sp. ( – ). , minus ( 10 % Cyclaneusma ). , 61 34 % , 20 - . Dothistroma pini , . S. sapinea S. pithyophila 82, - Fusicoccum sp. ( 14 % , ). , , Dothistroma sp., , D. pini Ɋɢɫ. 1. Dothistroma pini ( 1% 168 ) Dothistroma septosporum ( ) . . , [6, 9, 11]. ȼɵɜɨɞɵ. , , 10 : Alternaria sp., D. pini., Fusarium sp., Fusicoccum sp., G. abietina, L. seditiosum, Phomopsis sp. S. sapinea, S. pithyophila, C. minus c . , G. abietina, S. sapinea – S. pithyophila. S. pithyophila. Fusicoccum sp. . , 86 % , . D. pini, D. pini. Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ 1. ( . ., « 2. . ., . 110. . 226–229 3. . ., Tour є . . // »). 2011. № 9. . 57–62. . . Dothistroma septosporum – // . 2006. . . Pinus sylvestris L. P. sibirica Du // : . 3. , , 23–29 2011, . : . 2011. . 38–39. 4. . . // . 2009. . XXVI, № 1. . 105–109. 5. . ., . . – // . : . 2006. . 42–59. 6. Singlair W.A., Lyon H.H. Diseases of trees and shrubs. N. Y.: Cornell university Press, Sage House, 2005. 660 p. 7. . ., є . . // : . . .. . 90. . . . . . . .: . 2011. . 40–41. 8. Barnes I., Crous P.W., Wingfield B.D., Wingfield M.J. Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini. // Studies in Mycology, 2004, vol. 50, . 551–565. 9. Ioos R., Fabre B., Saurat C., Fourrier C., Frey P., Marçais B. Development, comparison, and validation of real-time and conventional PCR tools for the detection of the fungal pathogens causing brown spot and red band needle blights of pine. Phytopathology, 2008, vol. 100, pp. 105–114. 10. є . ., . ., . . // . 169 - . 2014. . 207 , . . . є (10–13 2012 .). . 1. .: . 2012. .257–259 12. Burgess T., Wingfield M.J., Wingfield B.W. Simple sequence repeat markers distinguish among morphotypes of Sphaeropsis sapinea. // Applied and Environmental Microbiology, 2001, vol. 67, pp. 354–362. 11. Barnes I., Kirisits T., Akulov A.Yu., Chhetri D.B., Wingfield B.D., Bulgakov T.S., Wingfield M.J. New host and country records of the Dothistroma needle blight pathogens from Europe and Asia. // Forest Pathology. 2008, vol. 38, . 178–195. Ⱦɚɜɢɞɟɧɤɨ ȿ.ȼ. // . 207. . 164–170. 2014. sylvestris) . (P. pallasiana), - . (Pinus - , . . 10 (Alternaria sp., Dothistroma sp., Fusarium sp., Fusicoccum sp., Gremmeniella abietina, Lophodermium seditiosum, Phomopsis sp. Sphaeropsis sapinea, Sclerophoma pithyophila, Cyclaneusma minus) . : , Sphaeropsis, Dothistroma, Cyclaneusma, Fusicoccum, . Davydenko E.V. Fungal pathogens of pine plantations of south Ukraine. Izvestia Sankt-Peterburgskoj Lesotehniceskoj Akademii, 2014, is. 207, pp. 164–170 (in Russian with English summary). The aim of the study was to reveal the complex of fungal pathogens associated with needle of Scots pine (Pinus sylvestris) and Crimean pine (P. pallasiana) in three regions of south Ukraine. The samples of symptomatic needles in pine plantations were collected. The material was used to identify the complex of fungal pathogens with microscopic and PCR based methods. In total, 10 fungal pathogens have been identified using microscopic and molecular methods for pine plantations of Zaporozhye, Nikolayev, and Kherson regions. The following fungal pathogens Alternaria sp., Dothistroma sp., Fusarium sp., Fusicoccum sp., Gremmeniella abietina, Lophodermium seditiosum, Phomopsis sp. Sphaeropsis sapinea, Sclerophoma pithyophila, Cyclaneusma minus were detected with different frequencies. K e y w o r d s : forest disease, Sphaeropsis, Dothistroma, Cyclaneusma, Fusicoccum, pine plantations. ȾȺȼɂȾȿɇɄɈ ȿɤɚɬɟɪɢɧɚ ȼɚɥɟɪɶɟɜɧɚ, , « » . . . . SPIN- : 1289-8697. 61024, . , . 86, . , . -mail: davidenkoKV@mail.ru DAVYDENKO Ekateryna V., PhD (Agriculture), Ukrainian honored with «Znak Poshany» Research Institute of Forestry and Forest Melioration named after G.N. Vysotsky. SPIN- : 1289-8697. 61024. Pushkinska str. 86. Kharkov. Ukraine. -mail: davidenkoKV@mail.ru 170